Contenuto principale

fastqwrite

R2026b

Write to file using FASTQ format

Syntax

fastqwrite(File, FASTQStruct)
fastqwrite(File, Header, Sequence, Qual)

Description

fastqwrite(File, FASTQStruct) writes the contents of a MATLAB® structure or array of structures to a FASTQ-formatted file. If you specify an existing FASTQ-formatted file, fastqwrite appends the data to the file, instead of overwriting the file.

fastqwrite(File, Header, Sequence, Qual) writes header, sequence, and quality information to a FASTQ-formatted file.

Tip

To append FASTQ-formatted data to an existing file, simply specify that file name. fastqwrite adds the data to the end of the file.

If you are using fastqwrite in a script, you can disable the append warning message by entering the following command lines before the fastqwrite command:

warnState = warning %Save the current warning state
warning('off','Bioinfo:fastqwrite:AppendToFile'); 
Then enter the following command line after the fastqwrite command:
warning(warnState) %Reset warning state to previous settings

Input Arguments

File

Character vector or string specifying either a file name or a path and file name for saving the FASTQ-formatted data. If you specify only a file name, fastqwrite saves the file to the MATLAB Current Folder. If you specify an existing file, fastqwrite appends the data to the file, instead of overwriting the file.

FASTQStruct

MATLAB structure or array of structures containing the fields Header, Sequence, and Quality, such as returned by fastqread.

Header

Character vector or string containing header information about the nucleotide sequence. This text appears in the header of the FASTQ-formatted file, File.

Sequence

Character vector or string containing a nucleotide sequence using the standard IUB/IUPAC letter or integer codes. For a list of valid characters, see Amino Acid Lookup or Nucleotide Lookup.

Qual

Character vector or string containing ASCII representation of per-base quality scores for a nucleotide sequence.

Examples

Write multiple sequences to a FASTQ file from an array of structures:

% Read the contents of a FASTQ-formatted file into
% an array of structures
reads = fastqread('SRR005164_1_50.fastq');
% Create another array of structures for the first five reads
reads5 = reads(1:5);
% Write the first five reads to a separate FASTQ-formatted file
fastqwrite('fiveReads.fastq', reads5)

Write a single sequence to a FASTQ file from separate variables:

% Create separate variables for the header, sequence, and 
% quality information of a nucleotide sequence
h = 'MYSEQ-000_1_1_1_953_493';
s = 'GTTACCATGATGTTATTTCTTCATTTGGAGGTAAAA';
q = ']]]]]]]]]]]]]]]]]]]]]]T]]]]RJRZTQLOA';
% Write the information to a FASTQ-formatted file
fastqwrite('oneRead.fastq', h, s, q)

More About

collapse all

Version History

Introduced in R2009b