Risposto
Vectorizing a loop that calculates cosd on every element?
You don't need vectorization to avoid computing the cosine on every iteration through the lambda loop - just put the calculation...

circa 11 anni fa | 0

| accettato

Risposto
what is the difference between imshow(im) or imshow(im, [])
If the second argument is not a spatial referencing object, a colormap or a string, it specifies the display range. From the <ht...

circa 11 anni fa | 1

Risposto
I need help arranging two vectors
[AreaSorted, idx] = sort(Area); LengthSorted = Length(idx); WidthSorted = Width(idx);

circa 11 anni fa | 2

Risposto
changing time from decimal days to +- 0 from high water
Guessing a bit, because you don't tell us what |pf| and |tf| are, but assuming they are water height and time vectors, I suspect...

circa 11 anni fa | 0

| accettato

Risposto
tell me about the methods to display an image and to display a part of image
See doc imshow You can select part of an image using indexing, or if you have the Image Processing Toolboox, with |imcro...

circa 11 anni fa | 0

Risposto
Percentile of a value based on array of data
% Test data historicalData = rand(1000, 1); exogenousVariable = 0.7; % Compute centile nless = sum(historicalDat...

circa 11 anni fa | 2

| accettato

Risposto
What is the restriction of using FFT ?
The points made apply to Fourier analysis in general, not specifically to the FFT, and amount to asking whether the model you ar...

circa 11 anni fa | 1

| accettato

Risposto
Please help, logical indexing of 3D matrices
One way, slightly fiddly but the simplest I can think of now: [rowsB, colsB] = find(B); C = zeros(size(B)); ind3 = 1;...

circa 11 anni fa | 0

Risposto
Using ifft to Recover Cosine from Two Delta Impulses
There are a number of reasons for the differences: * You do not need to divide by |No| after either the forward or backward t...

circa 11 anni fa | 1

| accettato

Risposto
How to interpret Binary '0' and '1' as Decimal 0 and 1?
One way: cdec = c - '0';

circa 11 anni fa | 1

| accettato

Risposto
How can I read global variables?
The problem is not connected with your use of a global variable. I think there are two possibilities: * If you click in the f...

circa 11 anni fa | 0

| accettato

Risposto
Finding when data in a matrix exceeds a certain value
find(X > 0, 1)

circa 11 anni fa | 0

Risposto
How to create large (multiline) text file in matlab?
Yes, see doc fprintf or look <http://uk.mathworks.com/help/matlab/ref/fprintf.html here>. Multiple lines are achieved us...

circa 11 anni fa | 0

Risposto
Error using * Inner matrix dimensions must agree.
It's likely that this line y = x1k * x2k; should be y = x1k .* x2k; The * operator does matrix multiplication, b...

circa 11 anni fa | 0

Risposto
what is the size of the matrix of an image.will it is different for color images.
See the documentation for the Image Processing Toolbox, for example <http://uk.mathworks.com/help/images/image-types-in-the-tool...

circa 11 anni fa | 0

Risposto
function kmeans is not able to process uint8 what should i do?
Convert your date to double before passing it to kmeans. For example, if Xi is your uint8 data array, Xd = double(Xi); i...

circa 11 anni fa | 0

Risposto
"load_image" function help.
I do not know why the author chose this particular image for his examples, but there is a discussion of it <http://en.wikipedia....

circa 11 anni fa | 0

| accettato

Risposto
watershed segmentation
Good questions, but it's not clear what the link to MATLAB is. Anyway, you could do worse than start with <http://en.wikipedia.o...

circa 11 anni fa | 1

Risposto
interpolation data and FFT resolution
The frequency resolution is always 1/T, where T is the time from the start to the end of the time series. The resolution is inde...

oltre 11 anni fa | 4

| accettato

Risposto
Why must a function in the methods block of a class have an input argument?
The method declaration needs to start function stiffnessk(obj) The argument it needs is the object for which it is being...

oltre 11 anni fa | 3

Risposto
CONVERT DNA SEQUENCE INTO COMPLEX NUMBER
values('ATCG') = [-1+1i 1-1i -1-1i 1+1i]; % mapping from characters to complex s = 'ATCGCGCGATATATCGCGCG'; % any sp...

oltre 11 anni fa | 0

Risposto
conv2() for gray images
I'm not sure why you are converting i3 to uint8 before passing it to imshow. Try imshow(i3, []); which automatically sca...

oltre 11 anni fa | 0

Risposto
Detcting irregular circles with different sizes
You could consider the Hough Transform. The best place to start is <http://uk.mathworks.com/help/images/ref/imfindcircles.html i...

oltre 11 anni fa | 0

Risposto
mapping numbers to another number
I don't see why switching case might be relevant to this problem. Put the numbers you want to map to into an array outpu...

oltre 11 anni fa | 2

Risposto
Repeat previous row if condition
% Parameters cycleLength = 4; % number of rows in a cycle indexMult = 10; % multiplier for index within cycle ...

oltre 11 anni fa | 0

| accettato

Risposto
fft - Documentation Question - What is "L"?
It's the number of data points in the synthesised signal vector. It didn't come from anywhere - the person writing the documenta...

oltre 11 anni fa | 0

| accettato

Risposto
How to go to a main function from sub-function if sub-function is recursive? "return" does not work here
If the recursive function is structured properly, returning from the final call when the termination condition is satisfied will...

oltre 11 anni fa | 1

Risposto
Hough Transform - Finding the center of the hough transform circles
If it helps at all, <http://uk.mathworks.com/matlabcentral/fileexchange/26978-hough-transform-for-circles my version> of the FEX...

oltre 11 anni fa | 0

Risposto
Combining cells so items occur randomly or pseudorandomly within a new array
% test data expitemorder = { 'Strong_Alt_Prime2.png' 'Strong_Alt_Target2.png' 'Strong_Alt_Prime1.png' ...

oltre 11 anni fa | 0

Risposto
starting indexing of an array at values greater than 1
All MATLAB arrays are indexed from 1, but an alternative to Stephen Cobeldick's answer is to make an array Ashifted such that t...

oltre 11 anni fa | 0

Carica altro