Risposto
What do the pixelIdxlist mean?
Let's say your image input for bwconncomp is BW. i.e. CC = bwconncomp(BW); Then CC.pixelIdxList{i} is linear indices of i-th i...

oltre 6 anni fa | 0

Risposto
Visualization of data in 3 dimention.
F=5:1:50; % total 46 value w=2*pi*F; S=0:1:100;%total 101 value [wM,SM]=meshgrid(w,S); P = SM./wM; surf(w,S,P) You can c...

oltre 6 anni fa | 1

| accettato

Risposto
comparing pixels in 3x3 block
Assuming your matrix is A % collect green pixels query_right = A(2:end-1,3:end); query_left = A(2:end-1,1:end-2); query_dow...

oltre 6 anni fa | 1

| accettato

Inviato


surferror
draws surf plot with errorbar

oltre 6 anni fa | 1 download |

0.0 / 5
Thumbnail

Risposto
How do I add error bars in the Z-axis to a surface plot?
https://kr.mathworks.com/matlabcentral/fileexchange/73699-surferror try this

oltre 6 anni fa | 1

Domanda


Collapsing preallocated memory of sparse matrix
I used sparse matrix for some calculation, and I roughly know how many nnz will be stored. So I preallocated a slightly larger m...

oltre 7 anni fa | 1 risposta | 1

1

risposta

Inviato


nargout_class
nargout for methods, and inherited methods

oltre 7 anni fa | 1 download |

0.0 / 5

Domanda


Is there any way to set function (or method) output as comma separated list?
If we have an array of struct, like this: s(1).a = 1; s(2).a = 2; s(3).a = 3; and then if we get the field of this...

oltre 7 anni fa | 2 risposte | 0

2

risposte

Risposto
Matrix Manipulation of a specific column
Assuming |Data| is the matrix that containing your data, threshold = 10; for i = size(Data,2) pickedColumn = ...

oltre 7 anni fa | 0

Domanda


How to get all possible rearrange permutations of array with repeated elements?
I have some DNA sequences to rearrange 'ACTCACATCTGGTTCCTCTA' and I need all possible permutations of this (4 'A', 7 'T'...

oltre 7 anni fa | 1 risposta | 0

1

risposta

Risolto


Find all elements less than 0 or greater than 10 and replace them with NaN
Given an input vector x, find all elements of x less than 0 or greater than 10 and replace them with NaN. Example: Input ...

oltre 8 anni fa

Risolto


Column Removal
Remove the nth column from input matrix A and return the resulting matrix in output B. So if A = [1 2 3; 4 5 6]; and ...

oltre 8 anni fa

Risolto


Determine if input is odd
Given the input n, return true if n is odd or false if n is even.

oltre 8 anni fa

Risolto


Add two numbers
Given a and b, return the sum a+b in c.

oltre 8 anni fa

Risolto


Find the sum of all the numbers of the input vector
Find the sum of all the numbers of the input vector x. Examples: Input x = [1 2 3 5] Output y is 11 Input x ...

oltre 8 anni fa

Risolto


Times 2 - START HERE
Try out this test problem first. Given the variable x as your input, multiply it by two and put the result in y. Examples:...

oltre 8 anni fa

Risolto


Make the vector [1 2 3 4 5 6 7 8 9 10]
In MATLAB, you create a vector by enclosing the elements in square brackets like so: x = [1 2 3 4] Commas are optional, s...

oltre 8 anni fa