Problem 47513. DNA Sequence Assembly
DNA fragments are made by DNA sequencer.
To find full sequence, we need to concatenate each other using common sequence information.
So, when Input sequences are
(1) ATCGATCGAAGTCATCGGGAAA
(3) GGAAAGATCGATTACTTCCGAAA
(2) CCGAAAACCTAAGGGTTCTCAATGAC .
Output sequence is
'ATCGATCGAAGTCATCGGGAAAGATCGATTACTTCCGAAAACCTAAGGGTTCTCAATGAC' .
Solution Stats
Solution Comments
Show commentsProblem Recent Solvers3
Suggested Problems
-
Find relatively common elements in matrix rows
2037 Solvers
-
1577 Solvers
-
9865 Solvers
-
330 Solvers
-
Divide elements by sum of elements
127 Solvers
More from this Author2
Problem Tags
Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!