Decoding DNA sequence into binary

I have a sequence TGACTCAGTCGTTCAATCTATGCC, how to write code in matlab to convert it into binary? Please help me..Thank you

3 Commenti

Please give an example of what exact output you would like for the above sequence.
The output should be 01100011 01110010 01111001 01110000 01110100 01101111
( A=00 T=01 G=10 C=11)
Dabba Do
Dabba Do il 14 Feb 2018
Modificato: Dabba Do il 14 Feb 2018
IF: every A matches to a T, THEN: the output for an A or a T is the same. The same is true of G and C they are a pair. So there are only two pairs, why not try defining each pair as a 1 or a 0. So if A and T = 1 and G and C = 0 then: the sequence TGACTCAGTGTTCAATCTATGCC would be: 101010101001101110111000. By coding each codon with a 1 and a 0 you are going to con-volute the Bits in your code and they work as pairs representing a single genetic Bit.

Accedi per commentare.

 Risposta accettata

James Tursa
James Tursa il 23 Set 2015
Modificato: James Tursa il 23 Set 2015
One way:
s = 'TGACTCAGTCGTTCAATCTATGCC'; % Input DNA string
[~,x] = ismember(s,'ATGC'); % Convert the ATGC into indexes
c = {'00','01','10','11'}; % Numeric strings to convert the indexes into
result = cell2mat(c(x)); % Convert the indexes into the numeric strings

Più risposte (4)

You can use
str = ('TGACTCAGTCGTTCAATCTATGCC');
[~,~,ind] = unique(double(str)-65);
dec2bin(ind-1)
Suresma Jena
Suresma Jena il 27 Ago 2017

0 voti

i want to how to convert a DNA sequence into binary. ex- if x = ATGCAT then its binary sequence will be xA = 100010 xT = 010001 xG = 001000 xC = 000100

6 Commenti

James Tursa
James Tursa il 29 Ago 2017
Modificato: James Tursa il 29 Ago 2017
x = 'ATGCAT';
xA = x == 'A';
xT = x == 'T';
xG = x == 'G';
xC = x == 'C';
Results will be logical. If you want character results then you can add '0' to the above lhs variables and convert to char. E.g.,
xA = char((x == 'A') + '0');
xT = char((x == 'T') + '0');
xG = char((x == 'G') + '0');
xC = char((x == 'C') + '0');
I have a DNA sequence in FASTA format. I want to convert this DNA sequence into two bit binary sequence such that a sequence reading x=' ATCGA' will be converted into '0001101100'. the coding will be A=00, C=01,G=10 and G=11. please send suggestions.
Can I replace a text file which contain the string with s ?
s = fileread('NameOfTextFileGoesHere');
A pseudo random binary sequence of size 256 * 256 is generated with two 1 D logistic maps , from which 3-bit disjoint and consecutive binary sequences are extracted to choose DNA coding rule, as follows 000 ( 00-A,01-C 10-G,11-T) 001(00-A,01-G,10-C,11-T) 010(00-C,01-A,10-T,11-G) 011( 00-C ,01-T,10-A,11-G) 100( 00-G, 01-A,10-T,11-C) 101(00-G,01-T,10-A, 11-C) 110(00-T,01-C,10-G,11-A) 111( 00-T,01-G,10-C,11-A) . please help me sir how to implement in matlab

Accedi per commentare.

Siyab Khan
Siyab Khan il 15 Gen 2019
Modificato: Siyab Khan il 15 Gen 2019

0 voti

Please also write code for DNA sequencig in 4 bits
via this given schema
4 2 1 0
N = 0 0 0 1 N represents the gap in DNA sequence
A = 0 1 0 0
T = 1 0 0 0
C = 0 0 1 0
G = 0 1 1 0
Khaled belkacemi
Khaled belkacemi il 4 Apr 2022
Modificato: Khaled belkacemi il 4 Apr 2022

0 voti

Hello,can someone help me to do the code for this situation? example of input data:0121212002202021101110002
and i want to code my data as this array

Categorie

Community Treasure Hunt

Find the treasures in MATLAB Central and discover how the community can help you!

Start Hunting!

Translated by