how to import gene fasta file from NCBI using matlab 2016a

I want to import gene fasta file from NCBI database using the Accession Number. I use the code Data = getgenbank('NP_752927.1'); but, getting this error : Error using getncbidata (line 191) The key NP_752927.1 was not found in the nucleotide database at this time. Please check that the input is a valid accession number or try again.

NOTE: This function is dependent on NCBI's Entrez tools and sequence databases. Changes to either may cause this function to break.

Error in getgenbank (line 70)

    [varargout{1:nargout}] = getncbidata(accessnum,'fileformat','GenBank','database','nucleotide',varargin{:});

How will i resolve the error?

Answer 1

[Paola Favaretto]

Are you sure it is a valid accession number? When I search the NCBI databases with the id you provided, I get 0 results.

[Priyanka Roy]

Escherichia coli O157:H7 str. Sakai, complete genome. NCBI Reference Sequence: NC_002695.1 ACCESSION NC_002695

I can manually download the Fasta file from NCBI database, but getting the same error while using the code : Data = getgenbank('NC_002695');

what will be the code for importing the fasta file directly from NCBI database ?

Answer 2

[Paola Favaretto]

What version of Bioinformatics Toolbox are you using? I am able to download the sequence without issues.

You can get the sequence information by typing:

a = getgenbank('NC_002695', 'sequenceonly', true)

Or you can save the sequence in a FASTA formatted file by typing:

a = getgenbank('NC_002695', 'tofile', 'S:/myfile2.fa', 'fileformat', 'fasta')

This is a snippet of the output:

a = 

    struct with fields:

        Header: 'NC_002695.1 Escherichia coli O157:H7 str. Sakai, complete genome'
      Sequence: 'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTCTCTGACAGC ...'

[Priyanka Roy]

Thanks :)

[Priyanka Roy]

i am using matlab 2016a

[Priyanka Roy]

I run the code:

a = getgenbank('NC_002695', 'sequenceonly', true)

and then got this error:

Error using getncbidata (line 227) Cannot save the contents of the URL to 'C:\Users\Su\AppData\Local\Temp\tp1f17e28a_9c1a_40e3_a428_c56374602d85'.

Error in getgenbank (line 70) [varargout{1:nargout}] = getncbidata(accessnum,'fileformat','GenBank','database','nucleotide',varargin{:});

[Paola Favaretto]

See if this patch solves your problem. (NCBI switched their protocol to https in late September 2016).

If not, I suggest you contact MathWorks Customer Support to get the help you need to solve your particular problem.