Window length Selection size for DNA sequence?
Mostra commenti meno recenti
i have a DNA sequence like
ATTCGATTGCCCAATTGGCTTATCCAATACTGGGA and wanna read the DNA sequcnce on a window size 5 ,10 and 15 so how to do this?? please drop a code
Risposte (0)
Categorie
Scopri di più su Genomics and Next Generation Sequencing in Centro assistenza e File Exchange
il 28 Gen 2019
Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!
Translated by 
