Azzera filtri
Azzera filtri

Window length Selection size for DNA sequence?

2 visualizzazioni (ultimi 30 giorni)
Siyab Khan
Siyab Khan il 28 Gen 2019
i have a DNA sequence like
ATTCGATTGCCCAATTGGCTTATCCAATACTGGGA and wanna read the DNA sequcnce on a window size 5 ,10 and 15 so how to do this?? please drop a code

Accedi per rispondere a questa domanda.

Risposte (0)

Categorie

Scopri di più su Genomics and Next Generation Sequencing in Help Center e File Exchange

Tag

Prodotti


Release

R2014a

Community Treasure Hunt

Find the treasures in MATLAB Central and discover how the community can help you!

Start Hunting!

Translated by