Window length Selection size for DNA sequence?
4 visualizzazioni (ultimi 30 giorni)
Mostra commenti meno recenti
i have a DNA sequence like
ATTCGATTGCCCAATTGGCTTATCCAATACTGGGA and wanna read the DNA sequcnce on a window size 5 ,10 and 15 so how to do this?? please drop a code
0 Commenti
Risposte (0)
Vedere anche
Categorie
Scopri di più su Genomics and Next Generation Sequencing in Help Center e File Exchange
Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!