Main Content

Testo e caratteri

Testo in array di stringhe

Quando si lavora con il testo, racchiudere le sequenze di caratteri tra virgolette doppie. È possibile assegnare del testo a una variabile.

t = "Hello, world";

Se il testo include delle virgolette doppie, usare due virgolette doppie all'interno della definizione.

q = "Something ""quoted"" and something else."
q = 

    "Something "quoted" and something else."

t e q sono array, come tutte le variabili di MATLAB®. La loro classe o tipo di dati è string.

whos t
  Name        Size            Bytes  Class     Attributes
  t           1x1               174  string   

Per aggiungere testo alla fine di una stringa, utilizzare l'operatore +.

f = 71;
c = (f-32)/1.8;
tempText = "Temperature is " + c + "C"
tempText = 
"Temperature is 21.6667C"

Come accade con gli array numerici, gli array di stringhe possono presentare elementi multipli. Utilizzare la funzione strlength per trovare la lunghezza di ciascuna stringa all'interno di un array.

A = ["a","bb","ccc"; "dddd","eeeeee","fffffff"]
A = 
  2×3 string array
    "a"       "bb"        "ccc"    
    "dddd"    "eeeeee"    "fffffff"
strlength(A)
ans =

     1     2     3
     4     6     7

Dati negli array di caratteri

A volte i caratteri rappresentano dati che non corrispondono a testo, come una sequenza di DNA. È possibile memorizzare questo tipo di dati in un array di caratteri, che presenta il tipo di dati char. Per gli array di caratteri si utilizzano gli apici.

seq = 'GCTAGAATCC';
whos seq
  Name      Size            Bytes  Class    Attributes
  seq       1x10               20  char               

In questo caso, ciascun elemento dell'array contiene un carattere singolo.

seq(4)
ans = 
    'A'

Concatenare gli array di caratteri con parentesi quadre, come si farebbe con gli array numerici.

seq2 = [seq 'ATTAGAAACC']
seq2 =
    'GCTAGAATCCATTAGAAACC'

Gli array di caratteri sono diffusi nei programmi scritti prima dell'introduzione delle virgolette doppie per la creazione di stringhe in R2017a. Tutte le funzioni di MATLAB che accettano i dati string accettano anche i dati char e viceversa.