Main Content

La traduzione di questa pagina non è aggiornata. Fai clic qui per vedere l'ultima versione in inglese.

Testo e caratteri

Testo in array di stringhe

Quando si lavora con il testo, racchiudere le sequenze di caratteri tra virgolette doppie. È possibile assegnare del testo a una variabile.

t = "Hello, world";

Se il testo include delle virgolette doppie, usare due virgolette doppie all'interno della definizione.

q = "Something ""quoted"" and something else."
q = 

    "Something "quoted" and something else."

t e q sono array, come tutte le variabili di MATLAB®. La loro classe o tipo di dati è string.

whos t
  Name        Size            Bytes  Class     Attributes
  t           1x1               174  string   

Nota

La creazione di array di stringhe con virgolette doppie è stata introdotta nella release R2017a. Se si utilizza una release precedente, creare array di caratteri. Per maggiori informazioni vedere Dati negli array di caratteri.

Per aggiungere testo alla fine di una stringa, utilizzare l'operatore +.

f = 71;
c = (f-32)/1.8;
tempText = "Temperature is " + c + "C"
tempText = 
"Temperature is 21.6667C"

Come accade con gli array numerici, gli array di stringhe possono presentare elementi multipli. Utilizzare la funzione strlength per trovare la lunghezza di ciascuna stringa all'interno di un array.

A = ["a","bb","ccc"; "dddd","eeeeee","fffffff"]
A = 
  2×3 string array
    "a"       "bb"        "ccc"    
    "dddd"    "eeeeee"    "fffffff"
strlength(A)
ans =

     1     2     3
     4     6     7

Dati negli array di caratteri

A volte i caratteri rappresentano dati che non corrispondono a testo, come una sequenza di DNA. È possibile memorizzare questo tipo di dati in un array di caratteri, che presenta il tipo di dati char. Per gli array di caratteri si utilizzano gli apici.

seq = 'GCTAGAATCC';
whos seq
  Name      Size            Bytes  Class    Attributes
  seq       1x10               20  char               

In questo caso, ciascun elemento dell'array è una struttura con numerosi campi.

seq(4)
ans = 
    'A'

Concatenare gli array di caratteri con parentesi quadre, come si farebbe con gli array numerici.

seq2 = [seq 'ATTAGAAACC']
seq2 =
    'GCTAGAATCCATTAGAAACC'

Gli array di caratteri sono comuni nei programmi scritti prima dell'introduzione degli array di stringhe. Tutte le funzioni di MATLAB che accettano i dati string accettano anche i dati char e viceversa.